ifnar2 gene Search Results


gene exp ifnar2 hs01022059 m1  (Thermo Fisher)
94
Thermo Fisher gene exp ifnar2 hs01022059 m1
Gene Exp Ifnar2 Hs01022059 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp ifnar2 hs01022059 m1/product/Thermo Fisher
Average 94 stars, based on 1 article reviews
gene exp ifnar2 hs01022059 m1 - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier
gene exp ifnar2 hs01022060 m1  (Thermo Fisher)
89
Thermo Fisher gene exp ifnar2 hs01022060 m1
Gene Exp Ifnar2 Hs01022060 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp ifnar2 hs01022060 m1/product/Thermo Fisher
Average 89 stars, based on 1 article reviews
gene exp ifnar2 hs01022060 m1 - by Bioz Stars, 2026-03
89/100 stars
  Buy from Supplier
gene exp ifnar2 hs00174198 m1  (Thermo Fisher)
91
Thermo Fisher gene exp ifnar2 hs00174198 m1
Human interferon pathway: Assay IDs and targets.
Gene Exp Ifnar2 Hs00174198 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp ifnar2 hs00174198 m1/product/Thermo Fisher
Average 91 stars, based on 1 article reviews
gene exp ifnar2 hs00174198 m1 - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier
gene exp ifnar2 mm00494916 m1  (Thermo Fisher)
86
Thermo Fisher gene exp ifnar2 mm00494916 m1
Human interferon pathway: Assay IDs and targets.
Gene Exp Ifnar2 Mm00494916 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp ifnar2 mm00494916 m1/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
gene exp ifnar2 mm00494916 m1 - by Bioz Stars, 2026-03
86/100 stars
  Buy from Supplier
gene exp ifnar2 bt03215061 m1  (Thermo Fisher)
93
Thermo Fisher gene exp ifnar2 bt03215061 m1
Human interferon pathway: Assay IDs and targets.
Gene Exp Ifnar2 Bt03215061 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp ifnar2 bt03215061 m1/product/Thermo Fisher
Average 93 stars, based on 1 article reviews
gene exp ifnar2 bt03215061 m1 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier
gene exp ifnar2 hs01022064 m1  (Thermo Fisher)
91
Thermo Fisher gene exp ifnar2 hs01022064 m1
Summary of genome-wide significant pQTLs.
Gene Exp Ifnar2 Hs01022064 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp ifnar2 hs01022064 m1/product/Thermo Fisher
Average 91 stars, based on 1 article reviews
gene exp ifnar2 hs01022064 m1 - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier
ifnar2 gene  (Human Protein Atlas)
90
Human Protein Atlas ifnar2 gene
Summary of genome-wide significant pQTLs.
Ifnar2 Gene, supplied by Human Protein Atlas, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ifnar2 gene/product/Human Protein Atlas
Average 90 stars, based on 1 article reviews
ifnar2 gene - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
gene exp ifnar2 rn01498715 m1  (Thermo Fisher)
88
Thermo Fisher gene exp ifnar2 rn01498715 m1
Summary of genome-wide significant pQTLs.
Gene Exp Ifnar2 Rn01498715 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp ifnar2 rn01498715 m1/product/Thermo Fisher
Average 88 stars, based on 1 article reviews
gene exp ifnar2 rn01498715 m1 - by Bioz Stars, 2026-03
88/100 stars
  Buy from Supplier

Image Search Results


Human interferon pathway: Assay IDs and targets.

Journal: Viruses

Article Title: Activation of Interferon-Stimulated Genes following Varicella-Zoster Virus Infection in a Human iPSC-Derived Neuronal In Vitro Model Depends on Exogenous Interferon-α

doi: 10.3390/v14112517

Figure Lengend Snippet: Human interferon pathway: Assay IDs and targets.

Article Snippet: Hs00174198_m1 , IFNAR2.

Techniques:

Summary of genome-wide significant pQTLs.

Journal: PLoS Genetics

Article Title: Function of multiple sclerosis-protective HLA class I alleles revealed by genome-wide protein-quantitative trait loci mapping of interferon signalling

doi: 10.1371/journal.pgen.1009199

Figure Lengend Snippet: Summary of genome-wide significant pQTLs.

Article Snippet: Fast TaqMan qPCR was performed using TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific) and TaqMan gene expression assays: Hs01022064_m1 ( IFNAR2c ), Hs00174198_m1 ( IFNAR2bc) , Hs00988304_m1 ( IFNGR1 ), Hs03043885_g1 ( RPL13A ) (all from ThermoFischer). mRNA levels of IFNAR2b were determined with custom designed primers and probes [ ]: Forward primer: CTATTCACAGGTGCAGTCATAATGC, Reverse primer:: GCACGCTTGTAATCCCAGCTA, Taqman probe: FAM-CAGTCGTCCTGCCTAAGCTTCCCCA-TAMRA.

Techniques: Genome Wide

(A-C) Data on IFNAR2 cell surface levels. (A) Regional association plot for IFNAR2 surface levels in CD56 dim NK cell and (B) boxplots stratified by rs28488669 and rs2186355. (C) Heat-map of the relation between p-values for the two cis -IFNAR2 pQTLs in different cell-types as specified. (D-E) Data on IFN-α induced phosphorylation of STAT4 (pSTAT4) and STAT1 (pSTAT1). (D) Regional association plot of the IFN-α induced pSTAT4 in CD56 dim NK cells and (E) boxplots stratified by rs2298260. (F) Heat-map of the relation between pQTL p-values for IFN-α induced pSTAT1 and pSTAT4 in indicated cell-types. (A and D) The genome-wide significance level (p < 5.0E-8) is denoted by a red line. (A-F) p-values from the full model using single (A, D-F), or two additive SNPs (B-C), ( n = 303). Boxplots show median, IQR and range. gMFI = geometric mean fluorescence intensity.

Journal: PLoS Genetics

Article Title: Function of multiple sclerosis-protective HLA class I alleles revealed by genome-wide protein-quantitative trait loci mapping of interferon signalling

doi: 10.1371/journal.pgen.1009199

Figure Lengend Snippet: (A-C) Data on IFNAR2 cell surface levels. (A) Regional association plot for IFNAR2 surface levels in CD56 dim NK cell and (B) boxplots stratified by rs28488669 and rs2186355. (C) Heat-map of the relation between p-values for the two cis -IFNAR2 pQTLs in different cell-types as specified. (D-E) Data on IFN-α induced phosphorylation of STAT4 (pSTAT4) and STAT1 (pSTAT1). (D) Regional association plot of the IFN-α induced pSTAT4 in CD56 dim NK cells and (E) boxplots stratified by rs2298260. (F) Heat-map of the relation between pQTL p-values for IFN-α induced pSTAT1 and pSTAT4 in indicated cell-types. (A and D) The genome-wide significance level (p < 5.0E-8) is denoted by a red line. (A-F) p-values from the full model using single (A, D-F), or two additive SNPs (B-C), ( n = 303). Boxplots show median, IQR and range. gMFI = geometric mean fluorescence intensity.

Article Snippet: Fast TaqMan qPCR was performed using TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific) and TaqMan gene expression assays: Hs01022064_m1 ( IFNAR2c ), Hs00174198_m1 ( IFNAR2bc) , Hs00988304_m1 ( IFNGR1 ), Hs03043885_g1 ( RPL13A ) (all from ThermoFischer). mRNA levels of IFNAR2b were determined with custom designed primers and probes [ ]: Forward primer: CTATTCACAGGTGCAGTCATAATGC, Reverse primer:: GCACGCTTGTAATCCCAGCTA, Taqman probe: FAM-CAGTCGTCCTGCCTAAGCTTCCCCA-TAMRA.

Techniques: Phospho-proteomics, Genome Wide, Fluorescence

(A) Regional association plots of the trans -IFNAR2 pQTL in B cells before (top) and after conditioning for rs2735099 (middle) and rs17199328 (bottom). (B-D) Boxplots of IFNAR2 levels in B cells (B), CD8 + T cells (C) and CD4 + T (D) cells stratified by rs2735099 and rs17199328 ( n = 301). (E-F) IFNAR1 (E) and IFNGR2 (F) surface levels in B cells ( n = 95). p-values from the full model using single (A, E and F), or two additive SNPs (B-D). Boxplots show median, IQR and range. gMFI = geometric mean fluorescence intensity.

Journal: PLoS Genetics

Article Title: Function of multiple sclerosis-protective HLA class I alleles revealed by genome-wide protein-quantitative trait loci mapping of interferon signalling

doi: 10.1371/journal.pgen.1009199

Figure Lengend Snippet: (A) Regional association plots of the trans -IFNAR2 pQTL in B cells before (top) and after conditioning for rs2735099 (middle) and rs17199328 (bottom). (B-D) Boxplots of IFNAR2 levels in B cells (B), CD8 + T cells (C) and CD4 + T (D) cells stratified by rs2735099 and rs17199328 ( n = 301). (E-F) IFNAR1 (E) and IFNGR2 (F) surface levels in B cells ( n = 95). p-values from the full model using single (A, E and F), or two additive SNPs (B-D). Boxplots show median, IQR and range. gMFI = geometric mean fluorescence intensity.

Article Snippet: Fast TaqMan qPCR was performed using TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific) and TaqMan gene expression assays: Hs01022064_m1 ( IFNAR2c ), Hs00174198_m1 ( IFNAR2bc) , Hs00988304_m1 ( IFNGR1 ), Hs03043885_g1 ( RPL13A ) (all from ThermoFischer). mRNA levels of IFNAR2b were determined with custom designed primers and probes [ ]: Forward primer: CTATTCACAGGTGCAGTCATAATGC, Reverse primer:: GCACGCTTGTAATCCCAGCTA, Taqman probe: FAM-CAGTCGTCCTGCCTAAGCTTCCCCA-TAMRA.

Techniques: Fluorescence

(A) Correlation between rs2735099 and rs17199328 genotypes and imputed HLA-A ( n = 301) and HLA-B alleles ( n = 303). (B) The proportion of B cells subsets in bulk B cells ( n = 95). (C) IFNAR2 surface levels in subsets of B cells from healthy donors ( n = 95). (D) IFNAR2 surface levels in subsets of B cells and T cells from healthy donors ( n = 22) and PwMS ( n = 26). (B-D) Data are stratified by the sum of the MS-protective class I alleles HLA-A*02, HLA-A*68 and HLA-B*44, as indicated. p-values from the full model (B-C) or a simple linear regression (D), using the sum of MS-protective alleles (0–3) as a continuous variable. Boxplots show median, IQR and range. gMFI = geometric mean fluorescence intensity.

Journal: PLoS Genetics

Article Title: Function of multiple sclerosis-protective HLA class I alleles revealed by genome-wide protein-quantitative trait loci mapping of interferon signalling

doi: 10.1371/journal.pgen.1009199

Figure Lengend Snippet: (A) Correlation between rs2735099 and rs17199328 genotypes and imputed HLA-A ( n = 301) and HLA-B alleles ( n = 303). (B) The proportion of B cells subsets in bulk B cells ( n = 95). (C) IFNAR2 surface levels in subsets of B cells from healthy donors ( n = 95). (D) IFNAR2 surface levels in subsets of B cells and T cells from healthy donors ( n = 22) and PwMS ( n = 26). (B-D) Data are stratified by the sum of the MS-protective class I alleles HLA-A*02, HLA-A*68 and HLA-B*44, as indicated. p-values from the full model (B-C) or a simple linear regression (D), using the sum of MS-protective alleles (0–3) as a continuous variable. Boxplots show median, IQR and range. gMFI = geometric mean fluorescence intensity.

Article Snippet: Fast TaqMan qPCR was performed using TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific) and TaqMan gene expression assays: Hs01022064_m1 ( IFNAR2c ), Hs00174198_m1 ( IFNAR2bc) , Hs00988304_m1 ( IFNGR1 ), Hs03043885_g1 ( RPL13A ) (all from ThermoFischer). mRNA levels of IFNAR2b were determined with custom designed primers and probes [ ]: Forward primer: CTATTCACAGGTGCAGTCATAATGC, Reverse primer:: GCACGCTTGTAATCCCAGCTA, Taqman probe: FAM-CAGTCGTCCTGCCTAAGCTTCCCCA-TAMRA.

Techniques: Fluorescence

(A) A schematic picture of the IFNAR2 isoforms. (B) IFNAR2bc , IFNAR2b and IFNAR2c mRNA levels in isolated B cells determined using qRT-PCR. mRNA levels are normalized to the expression of the reference gene RPL13A and expressed as arbitrary units (AU) ( n = 47, simple linear regression using the sum of MS-protective class I alleles (HLAsum) as independent variable). (C) Correlation between IFNAR2bc mRNA levels and IFNAR2 surface receptor levels determined using flow cytometry ( n = 47). Data are binned into 0, 1 and ≥2 HLAsum. p-values and Pearson’s correlation coefficient (r) from linear regressions of each group are shown in coloured text. p-values from multiple linear regressions of the combined data using HLAsum (continuous variable) and mRNA values as independent variables in the full model are denoted in black. (D) Heat-maps comparing the correlation between IFNAR2 levels and IFN-α induced pSTAT1 (top) or pSTAT4 (bottom) in indicated cell-types with and without including HLAsum as a covariate in the full model ( n = 303). (E-G) Correlation between IFNAR2 protein levels and IFN-α (2000 IU/ml) induced pSTAT1 (E), pSTAT4 (F) and CXCL10 (G) in B cells. p-values as described in (C), ( n = 303). Boxplots show median, IQR and range. gMFI = geometric mean fluorescence intensity.

Journal: PLoS Genetics

Article Title: Function of multiple sclerosis-protective HLA class I alleles revealed by genome-wide protein-quantitative trait loci mapping of interferon signalling

doi: 10.1371/journal.pgen.1009199

Figure Lengend Snippet: (A) A schematic picture of the IFNAR2 isoforms. (B) IFNAR2bc , IFNAR2b and IFNAR2c mRNA levels in isolated B cells determined using qRT-PCR. mRNA levels are normalized to the expression of the reference gene RPL13A and expressed as arbitrary units (AU) ( n = 47, simple linear regression using the sum of MS-protective class I alleles (HLAsum) as independent variable). (C) Correlation between IFNAR2bc mRNA levels and IFNAR2 surface receptor levels determined using flow cytometry ( n = 47). Data are binned into 0, 1 and ≥2 HLAsum. p-values and Pearson’s correlation coefficient (r) from linear regressions of each group are shown in coloured text. p-values from multiple linear regressions of the combined data using HLAsum (continuous variable) and mRNA values as independent variables in the full model are denoted in black. (D) Heat-maps comparing the correlation between IFNAR2 levels and IFN-α induced pSTAT1 (top) or pSTAT4 (bottom) in indicated cell-types with and without including HLAsum as a covariate in the full model ( n = 303). (E-G) Correlation between IFNAR2 protein levels and IFN-α (2000 IU/ml) induced pSTAT1 (E), pSTAT4 (F) and CXCL10 (G) in B cells. p-values as described in (C), ( n = 303). Boxplots show median, IQR and range. gMFI = geometric mean fluorescence intensity.

Article Snippet: Fast TaqMan qPCR was performed using TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific) and TaqMan gene expression assays: Hs01022064_m1 ( IFNAR2c ), Hs00174198_m1 ( IFNAR2bc) , Hs00988304_m1 ( IFNGR1 ), Hs03043885_g1 ( RPL13A ) (all from ThermoFischer). mRNA levels of IFNAR2b were determined with custom designed primers and probes [ ]: Forward primer: CTATTCACAGGTGCAGTCATAATGC, Reverse primer:: GCACGCTTGTAATCCCAGCTA, Taqman probe: FAM-CAGTCGTCCTGCCTAAGCTTCCCCA-TAMRA.

Techniques: Isolation, Quantitative RT-PCR, Expressing, Flow Cytometry, Fluorescence

(A) Cis -eQTL analysis within ± 1 Mb from the HLA-A*02/A*68 and HLA-B*44 tag SNPs in LCLs ( n = 373). The p-value threshold of p < 3.2E-4, corresponding to a Bonferroni adjusted p-value of < 0.05 (155 analysed genes) is denoted with dotted lines. Data for 28 of the 155 genes are shown. The inset shows the transcript specific cis -eQTL p-values of HLA-J . (B) Correlation between p-values from the IFNAR2 pQTL in B cells and the cis -eQTL in LCLs for the transcript HLA-J-001 (left) and HCG4P5-001 (right). The HLA-A*02/A*68 and the B*44 tagging SNPs are marked in red and blue respectively. (C) Cis -meQTL analysis of the HLA-A*02/A*68 tagging SNP rs2735099 in primary B cells ( n = 43). The p-value threshold of p < 2.1E-6, corresponding to a Bonferroni adjusted p-value of < 0.05 (23, 722 analysed CpG-sites) is denoted with dotted red lines.

Journal: PLoS Genetics

Article Title: Function of multiple sclerosis-protective HLA class I alleles revealed by genome-wide protein-quantitative trait loci mapping of interferon signalling

doi: 10.1371/journal.pgen.1009199

Figure Lengend Snippet: (A) Cis -eQTL analysis within ± 1 Mb from the HLA-A*02/A*68 and HLA-B*44 tag SNPs in LCLs ( n = 373). The p-value threshold of p < 3.2E-4, corresponding to a Bonferroni adjusted p-value of < 0.05 (155 analysed genes) is denoted with dotted lines. Data for 28 of the 155 genes are shown. The inset shows the transcript specific cis -eQTL p-values of HLA-J . (B) Correlation between p-values from the IFNAR2 pQTL in B cells and the cis -eQTL in LCLs for the transcript HLA-J-001 (left) and HCG4P5-001 (right). The HLA-A*02/A*68 and the B*44 tagging SNPs are marked in red and blue respectively. (C) Cis -meQTL analysis of the HLA-A*02/A*68 tagging SNP rs2735099 in primary B cells ( n = 43). The p-value threshold of p < 2.1E-6, corresponding to a Bonferroni adjusted p-value of < 0.05 (23, 722 analysed CpG-sites) is denoted with dotted red lines.

Article Snippet: Fast TaqMan qPCR was performed using TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific) and TaqMan gene expression assays: Hs01022064_m1 ( IFNAR2c ), Hs00174198_m1 ( IFNAR2bc) , Hs00988304_m1 ( IFNGR1 ), Hs03043885_g1 ( RPL13A ) (all from ThermoFischer). mRNA levels of IFNAR2b were determined with custom designed primers and probes [ ]: Forward primer: CTATTCACAGGTGCAGTCATAATGC, Reverse primer:: GCACGCTTGTAATCCCAGCTA, Taqman probe: FAM-CAGTCGTCCTGCCTAAGCTTCCCCA-TAMRA.

Techniques: